Search

US-12618072-B2 - Methods of treatment of SCN2A-related disorders

US12618072B2US 12618072 B2US12618072 B2US 12618072B2US-12618072-B2

Abstract

Provided are methods of treating a subject with a SCN2A-related disorder, e.g., Developmental and Epileptic Encephalopathies (DEE), comprising administering to the subject an oligomeric compound. Also provided are methods of reducing frequency of seizures experienced by a subject with a SCN2A-related disorder, comprising administering to the subject an oligomeric compound.

Inventors

  • William Motel
  • Alyssa Wyant
  • Marjie HARD

Assignees

  • PRAXIS PRECISION MEDICINES, INC.

Dates

Publication Date
20260505
Application Date
20240913

Claims (20)

  1. 1 . A method of reducing frequency of seizures experienced by a subject with early onset SCN2A Developmental and Epileptic Encephalopathy (DEE) in need of treatment, said method comprising administering to said subject an effective amount of an oligomeric compound, wherein: the SCN2A DEE is caused by a gain-of-function mutation in SCN2A gene; the oligomeric compound comprises a 6-10-4 MOE gapmer having a sequence (from 5′ to 3′) of CCACGACATATTTTTCTACA (SEQ ID NO: 3); wherein each of nucleosides 1-6 and 17-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 7-16 are 2′-β-D-deoxynucleosides; wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages; and each cytosine is a 5-methyl cytosine; wherein the oligomeric compound is administered at a dose of about 0.5 mg to about 8 mg; wherein the subject is a human and is a newborn to 18 years old; and wherein the oligomeric compound is administered intrathecally.
  2. 2 . The method of claim 1 , wherein the oligomeric compound is administered at a dose of about 0.5 mg, about 0.6 mg, about 0.7 mg, about 0.8 mg, about 0.9 mg, about 1 mg, about 2 mg, about 2.5 mg, about 3 mg, about 3.5 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg or about 8 mg.
  3. 3 . The method of claim 1 , wherein the oligomeric compound is administered at a dose of about 0.5 mg, about 1 mg, about 4 mg or about 8 mg.
  4. 4 . The method of claim 3 , wherein the oligomeric compound is administered at a dose of about 1 mg.
  5. 5 . The method of claim 1 , wherein the oligomeric compound is administered about once per month.
  6. 6 . The method of claim 1 , wherein the seizures are selected from the group consisting of focal motor seizures, tonic seizures, generalized tonic-clonic seizures and myoclonic seizures.
  7. 7 . The method of claim 1 , wherein administration of the oligomeric compound results in a decrease in the average number of daily seizures experienced by the subject in a 28-day period, as compared to the average number of daily seizures experienced by the subject prior to administration of the oligomeric compound.
  8. 8 . The method of claim 1 , wherein administration of the oligomeric compound results in a reduction in the number of seizures experienced by the subject in a 28-day period by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%, as compared to the number of seizures experienced by the subject prior to administration of the oligomeric compound.
  9. 9 . The method of claim 1 , wherein the subject is between 2 and 18 years old.
  10. 10 . The method of claim 1 , wherein the subject is a newborn to 24 months old.
  11. 11 . The method of claim 10 , wherein the subject is a newborn.
  12. 12 . The method of claim 11 , wherein the newborn is a premature newborn.
  13. 13 . The method of claim 1 , wherein the gain-of-function mutation in SCN2A gene is selected from the group consisting of L210Q, A263V, E430A, R1882Q, G879R, Q1479H, V423L, G1593R, K1502N, V1601L, G211D, S1780I, D343H and A1329D.
  14. 14 . The method of claim 13 , wherein the gain-of-function mutation is A1329D.
  15. 15 . The method of claim 1 , wherein the oligomeric compound is a modified oligonucleotide represented by the following chemical structure: or a salt thereof.
  16. 16 . The method of claim 15 , wherein the modified oligonucleotide is a sodium salt or a potassium salt.
  17. 17 . The method of claim 16 , wherein the modified oligonucleotide is a sodium salt.
  18. 18 . The method of claim 17 , wherein the modified oligonucleotide represented by the following chemical structure:
  19. 19 . The method of claim 1 , wherein the oligomeric compound is administered as a part of a pharmaceutical composition comprising the oligomeric compound and a pharmaceutically acceptable diluent or carrier.
  20. 20 . The method of claim 19 , wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or phosphate-buffered saline (PBS).

Description

RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63/689,297, filed on Aug. 30, 2024; U.S. Provisional Patent Application No. 63/686,359, filed on Aug. 23, 2024; U.S. Provisional Patent Application No. 63/672,118, filed on Jul. 16, 2024; U.S. Provisional Patent Application No. 63/651,681, filed on May 24, 2024; U.S. Provisional Patent Application No. 63/604,103, filed on Nov. 29, 2023; U.S. Provisional Patent Application No. 63/542,017, filed on Oct. 2, 2023; and U.S. Provisional Patent Application No. 63/538,713, filed on Sep. 15, 2023. The entire contents of each of the foregoing applications are hereby incorporated herein by reference. SEQUENCE LISTING The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on Sep. 13, 2024, is named 137486-09408_SL.xml and is 69,914 bytes in size. BACKGROUND The human gene SCN2A encodes human SCN2A protein, the alpha-1 subunit of the voltage-gated sodium channel NaV1.2. Mutations in SCN2A are associated with a variety of neurodevelopmental and intellectual diseases and disorders, such as Developmental and Epileptic Encephalopathies (DEE), including Early Seizure Onset Epileptic Encephalopathy (EE), Late Seizure Onset Epileptic Encephalopathy, and Benign Familial Neonatal-Infantile Seizures (BFNIS). Mutations in SCN2A are also associated with intellectual disability (ID) and/or autism spectrum disorder (ASD), with or without seizures (Wolff, M., et al., 2019, Epilepsia 60, S59-S67; Sanders, S., et al., 2018, Trends in Neurosciences 41, 442-456; Wolff, M., et al., 2017, Brain 140, 1316-1336). DEEs include a broad range of diseases that include neonatal and early infantile DEE, for example Ohtahara Syndrome and epilepsy with migrating focal seizures of infancy (EIMFS); infantile and childhood DEE, for example West Syndrome and Lennon-Gastaut Syndrome; Dravet Syndrome; Idiopathic/Generic Generalized Epilepsies (IGE/GGE); Temporal Lobe Epilepsy; Myoclonic Astatic Epilepsy (MAE); Migrating Partial Epilepsy of Infancy (MMPSI); and familial hemiplegic migraines, with or without epilepsy (Wolff, M., et al., 2019; Harkin, L. A., et al., 2007, Brain 130, 843-852; Escayg, A., et al., 2010, Epilepsia 51, 1650-1658; Miller I. O, et al., 2007 Nov. 29 [Updated 2019 Apr. 18]. In: Adam M P, Ardinger H H, Pagon R A, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2020. Available from: www.ncbi.nlm.nih.gov/books/NBK1318/). Symptoms and hallmarks associated with DEEs include seizures, hypotonia, sensory integration disorders, motor development delays and dysfunctions, intellectual and cognitive dysfunctions, movement and balance dysfunctions, visual dysfunctions, delayed language and speech, gastrointestinal disorders, neurodevelopmental delays, sleep problems, and sudden unexpected death in epilepsy. Seizures include focal, clonic, tonic, and generalized tonic and clonic seizures, prolonged seizures (often lasting longer than 10 minutes), and frequent seizures (for example, convulsive, myoclonic, absence, focal, obtundation status, and tonic seizures) (Guzzetta, F., 2011, Epilepsia 52:S2, 35-38; Anwar et al., 2019, Cureus 11, e5006, Wolff et al., 2019). Symptoms and hallmarks associated with ID and ASD include motor development delays, delayed social and language milestones, repetitive actions, uncoordinated oral movements, gastrointestinal disorders, sleep problems, and seizures (Wolff et al., 2019). Currently there is a lack of acceptable options for treating DEEs such as EEs, Late Onset EEs, and BFNIS; and for treating ID and ASD. It is therefore an object herein to provide methods for the treatment of such diseases and disorders. SUMMARY OF THE INVENTION In one aspect, disclosed herein is a method of reducing frequency of seizures experienced by a subject with a SCN2A-related disorder, said method comprising administering to said subject an effective amount of an oligomeric compound, wherein: the SCN2A-related disorder is caused by a gain-of-function mutation in SCN2A gene; the oligomeric compound comprises a 6-10-4 MOE gapmer having a sequence (from 5′ to 3′) of CCACGACATATTTTTCTACA (SEQ ID NO: 3); wherein each of nucleosides 1-6 and 17-20 (from 5′ to 3′) are 2′-MOE nucleosides and each of nucleosides 7-16 are 2′-β-D-deoxynucleosides; wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages; and each cytosine is a 5-methyl cytosine. In some embodiments, the oligomeric compound is administered at a dose of about 0.1 mg to about 20 mg. In some embo