Search

US-20260125428-A1 - SYNTHETIC TRIPLEX PEPTIDE NUCLEIC ACID-BASED INHIBITORS FOR CANCER THERAPY

US20260125428A1US 20260125428 A1US20260125428 A1US 20260125428A1US-20260125428-A1

Abstract

A novel peptide nucleic acid (PNA) oligomer capable of forming a PNA/DNA/PNA triplex when binding to its target genomic DNA is described. An PNA oligomer directed to C-Myc oncogene was capable of binding the target DNA and effectively inhibit the transcription of the gene both in vitro as well as in vivo without causing any toxicity. Methods of making and using the novel PNA oligomer for targeting other genomic DNA are described.

Inventors

  • Raman Bahal
  • Shipra Malik
  • Vikas Kumar

Assignees

  • UNIVERSITY OF CONNECTICUT

Dates

Publication Date
20260507
Application Date
20230420

Claims (20)

  1. 1 . A peptide nucleic acid analogue (PNA) oligomer that forms a PNA/DNA/PNA triplex invasion complex with a homopurine region of a target deoxyribonucleic acid (DNA), wherein the PNA oligomer has the formula: 5′-first PNA segment-flexible linker 1-second PNA segment-3′ wherein the first PNA segment is complementary to a homopurine stretch in the target DNA, the second PNA segment is complementary to a region of the target DNA including the homopurine stretch, a nuclear localization signal (NLS) peptide is conjugated to a carboxyl-terminus (C-terminus), an amino-terminus (N-terminus), or both the C-terminus and N-terminus of the PNA oligomer, the first PNA segment and the second PNA segment form the PNA/DNA/PNA triplex structure with the target DNA, and the target DNA is genomic DNA.
  2. 2 . The PNA oligomer of claim 1 , wherein the first PNA segment, the second PNA segment, or both the first PNA segment and the second PNA segment comprises one or more gamma-modified monomer units.
  3. 3 . The PNA oligomer of claim 1 , wherein the first PNA segment comprises 3-10 pyrimidines.
  4. 4 . The PNA oligomer of claim 1 , wherein the first PNA segment comprises one or more pseudoisocytosine units.
  5. 5 . The PNA oligomer of claim 1 , wherein the first PNA segment comprises only pseudoisocytosine units and thymidine units.
  6. 6 . The PNA oligomer of claim 1 , wherein the flexible linker comprises 1-10 units of 8-amino-3,6-dioxaoctanoic acid, 8-amino-2, 6,10-trioxaoctanoic acid, or 11-amino-3, 6, 9-trioxaundecanoic acid.
  7. 7 . The PNA oligomer of claim 1 , wherein the NLS comprises the amino acid sequence 5′-VKRKKKP-3′.
  8. 8 . The PNA oligomer of claim 7 , wherein the NLS is conjugated to the PNA oligomer via a lysine amino acid.
  9. 9 . The PNA oligomer of claim 8 , wherein the target DNA is in a transcriptional control region of a gene.
  10. 10 . The PNA oligomer of claim 9 , wherein the transcriptional control region is a promoter, an enhancer, or a transcription-factor binding region of a gene.
  11. 11 . The PNA oligomer of claim 10 , wherein the gene is overexpressed in a disease state.
  12. 12 . The PNA oligomer of claim 11 , wherein the gene is an oncogene.
  13. 13 . The PNA oligomer of claim 12 , wherein the oncogene is Cellular myelocytomatosis (C-myc) and the second PNA segment is complementary to a region of C-myc and has the sequence 5′-TCCCTCCCTCCGTTCTTTTTCCC-3′ (SEQ ID NO: 16).
  14. 14 . The PNA oligomer of claim 1 , further comprising a detectable label.
  15. 15 . A composition comprising the PNA oligomer of claim 1 and a pharmaceutically acceptable excipient.
  16. 16 . A method for inhibiting gene transcription of a target genomic DNA involved in health disorders in a subject, the method comprising providing to a cell of the subject in vivo or ex vivo a PNA oligomer according to claim 1 , wherein the binding of the PNA oligomer to the targeted DNA reduces expression of the targeted gene.
  17. 17 . The method of claim 16 , further comprising administering a factor that opens chromatin DNA structure, wherein administering makes the target DNA accessible for PNA oligomer invasion.
  18. 18 . The method of claim 17 , wherein the factor is a histone deacetylation inhibitor (HDACi), a cytotoxic drug combination, a monotherapy, a poly (ADP-ribose) polymerase (PARP) inhibitor, or a combination thereof, wherein the HDACi is vorinostat, romidepsin, belinostat, panobinostat, tucidinostat, or a combination thereof; the monotherapy is selinexor, venetoclax, or a combination thereof; the poly (ADP-ribose) polymerase (PARP) inhibitor is Olaparib, rucaparib, niraparib, talazoparib, or a combination thereof; and the cytotoxic drug combination is: cyclophosphamide, doxorubicin hydrochloride, vincristine sulfate, and prednisone (CHOP); rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-POCH); etoposide phosphate, prednisone, vincristine sulfate, cyclophosphamide, doxorubicin hydrochloride (EPOCH); cyclophosphamide, vincristine, procarbazine hydrochloride, and prednisone (COPP); cyclophosphamide, vincristine sulfate, and prednisone (CVP); ifosfamide, carboplatin, and etoposide phosphate (ICE); rituximab, cyclophosphamide, vincristine sulfate, and prednisone (R-CVP); rituximab, etoposide phosphate, prednisone, vincristine sulfate, cyclophosphamide, and doxorubicin hydrochloride (R-EPOCH); rituximab, ifosfamide, carboplatin, and etoposide phosphate (R-ICE); or a combination thereof.
  19. 19 . The method of claim 18 , wherein the factor is administered prior to, along with, or post administration of the PNA oligomer.
  20. 20 . A method for increasing survival, reducing effects of the cancer, or reducing the size of a tumor, in a subject with Burkitt's lymphoma or diffuse large B cell lymphoma or another cancer overexpressing the oncogene, the method comprising administering to said subject a PNA oligomer of claim 13 , and optionally, administering a factor that opens chromatin DNA, wherein administering the factor makes the target DNA accessible for PNA oligomer invasion.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS This application is a National Stage Application of International Patent Application No. PCT/US2023/066007, filed 20 Apr. 2023, which claims priority to, and the benefit of, U.S. Provisional Application 63/334,839, filed on Apr. 26, 2022, each of which is incorporated by reference herein in its entirety. SEQUENCE LISTING The Instant Application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on 12 Jun. 2025, is named “UCT0293US2_Sequence_Listing.xml” and is 31,952 bytes in size. BACKGROUND Among several oncogenes dysregulated in cancer, transcription factors are the most challenging to inhibit due to their localization in the nucleus. Current therapeutics for effective inhibition of undruggable proteins focuses upon targeting the mRNA present in the cytoplasm to inhibit the translation of proteins. The field of RNA medicine has gained momentum with the approval of three RNA interference (RNAi) based drugs; Onpattro® (patisiran), Givlaari® (givosiran), and Oxlumo™ (lumasiran) along with the success of antisense oligonucleotides; Tegsedi® (inotersen), Vyondys 53 (golodirsen) and Milasen. Even though mRNA can be targeted to prevent protein synthesis, there are often multiple mRNA molecules present in the cytoplasm and more mRNA is continuously being transcribed from the DNA. Further, tissue specific delivery of antisense molecules to sites other than the liver is challenging. Moreover, no antisense based drug has been approved for the treatment of cancer. Although small molecules have been used to target the genomic DNA for cancer therapy, they bind non-specifically and are associated with severe toxicological issues. Hence, there is a need to develop clinically translatable platforms for sequence specific targeting of genomic DNA. BRIEF SUMMARY OF THE INVENTION The present disclosure provides a platform for targeting genomic DNA at the transcription activation site of oncogenes known to cause differentiation and proliferation of a wide range of tumors like breast cancer, hematological malignancies, prostate cancer, gastric cancer, lung, liver, pancreatic cancer and glioblastomas. Such a platform can be used as an adjunct therapy with chemotherapeutic drugs for treatment of resistant as well as relapsed tumors. In addition, a genomic DNA targeting strategy can also be utilized for inhibiting the transcription of genes involved in the pathophysiology of other non-malignant disorders. Moreover, the scope of this technology can be further expanded by targeting the genomic DNA to induce the activation of transcription leading to the proteins essential for normal physiological functions. In an aspect, a peptide nucleic acid (PNA) oligomer that forms a PNA/DNA/PNA triplex invasion complex with a homopurine region of a target DNA has the formula: 5′-first PNA segment-flexible linker 1-second PNA segment-3′ wherein the first PNA segment is complementary to a homopurine stretch in the DNA, the second PNA segment is complementary to a region of the DNA including the homopurine stretch, wherein a nuclear localization signal (NLS) peptide is conjugated to the oligomer at the C-terminus, N-terminus, or both C- and N-termini, wherein the first PNA segment and the second PNA segment form the PNA/DNA/PNA triplex structure with the DNA, and wherein the DNA is genomic DNA. In another aspect, the PNA is a gamma-modified PNA with one or more gamma-modified monomer units. In another aspect, a method for inhibiting transcription of a target gene involved in health disorders in a subject, comprising providing to a cell of the subject in vivo or ex vivo the above-described PNA oligomer, wherein the binding of the PNA oligomer to the targeted DNA region reduces expression of the targeted gene. In yet another aspect, a factor that opens chromatin DNA structure making the target DNA more accessible for PNA invasion is also administered. BRIEF DESCRIPTION OF THE DRAWINGS FIGS. 1A-C show the location and sequence of the target site and the sequences of the indicated PNAs. (1A) Organization of the C-MYC gene and position of the target sites. The gene map of C-MYC (GeneBank: AH002904.2; SEQ ID NO: 1) oncogene in humans. (1B) The sequence of the target site 1 (SEQ ID NO: 2) and target site 2 (SEQ ID NO: 3) upstream of the promoter 1 and promoter 2 respectively. (1C) Sequence of JPNAs designed to target the selected sites. X1CCTTCCCCACCCTCCCCACCCTCX2, wherein X1 is JJJJTTJJ-linker-, wherein J is pseudoisocytosine and the linker is 11-Amino-3,6,9-Trioxaundecanoic Acid, DCHA) represented as -OOO-, wherein X2 is K-linker-SEQ ID NO: 5 (SEQ ID NO: 4) X3TCCCTCCCTCCGTTCTTTTTCCCX2, wherein X3 is JJJTJJJT-linker, wherein J is pseudoisocytosine and the linker is 11-Amino-3,6,9-Trioxaundecanoic Acid, DCHA) represented as -OOO-, wherein X2 is K linker-SEQ ID NO: 5, wherein the linker is 11-Amino-3,6,9-T