Search

US-20260125661-A1 - Compositions and Methods for Kallikrein (KLKB1) Gene Editing

US20260125661A1US 20260125661 A1US20260125661 A1US 20260125661A1US-20260125661-A1

Abstract

Compositions and methods for editing, e.g., introducing double-stranded breaks, within the KLKB1 gene are provided. Compositions and methods for treating subjects having hereditary angioedema (HAE), are provided.

Inventors

  • Shobu Odate
  • Jessica Lynn Seitzer

Assignees

  • INTELLIA THERAPEUTICS, INC.

Dates

Publication Date
20260507
Application Date
20250912

Claims (20)

  1. 1 .- 50 . (canceled)
  2. 51 . A composition comprising: (a) a single guide RNA (sgRNA) comprising, in 5′ to 3′ order: (i) a guide sequence that is 20 to 25 nucleotides in length and comprises the nucleotide sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15); and (ii) a nucleotide sequence comprising GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:171); and (b) a messenger RNA (mRNA) comprising a sequence encoding a Streptococcus pyogenes Cas9 (SpyCas9) protein.
  3. 52 . The composition of claim 51 , wherein the sgRNA comprises at least one chemical modification of a sugar group or a phosphate group of a nucleotide within the sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO:15) or the sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG AAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:171).
  4. 53 . The composition of claim 52 , wherein the at least one chemical modification is (a) a replacement of the 2′ hydroxyl on the sugar group with 2′-O-methyl (a 2′-O-Me modification) and/or (b) the substitution of a nonbridging phosphate oxygen of the phosphate group with S- (a phosphorothioate (PS) bond).
  5. 54 . The composition of claim 53 , wherein the sgRNA comprises a 2′-O-Me modification at one or more of the first three nucleotides at the 5′ terminus of SEQ ID NO: 15 and/or at one or more of the last three nucleotides at the 3′ end of SEQ ID NO: 171.
  6. 55 . The composition of claim 53 , wherein the sgRNA comprises PS bonds between two or more of the first four nucleotides at the 5′ terminus of SEQ ID NO: 15 and/or between three or more of the last four nucleotides at the 3′ terminus of SEQ ID NO: 171.
  7. 56 . The composition of claim 52 , wherein the sgRNA comprises GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCG UUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCm GmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 405), wherein a * denotes a PS bond and “mA,” “mC,” “mU,” and “mG” each denote a nucleotide containing a 2′-O-Me modification.
  8. 57 . The composition of claim 56 , wherein the sgRNA comprises mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmAm GmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGm UmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 603), wherein a * denotes a PS bond and “mA,” “mC,” “mU,” and “mG” each denote a nucleotide containing a 2′-O-Me modification.
  9. 58 . The composition of claim 57 , wherein the sgRNA consists of mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmA mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAm GmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 603), wherein a * denotes a PS bond and “mA,” “mC,” “mU,” and “mG” each denote a nucleotide containing a 2′-O-Me modification.
  10. 59 . The composition of claim 51 , wherein the guide sequence is 20 nucleotides in length.
  11. 60 . The composition of claim 51 , wherein the composition further comprises a lipid nanoparticle (LNP) comprising an ionizable lipid.
  12. 61 . The composition of claim 60 , wherein the ionizable lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate.
  13. 62 . The composition of claim 60 , wherein the LNP further comprises a helper lipid, a neutral lipid, and a stealth lipid.
  14. 63 . The composition of claim 60 , wherein the LNP comprises: (i) (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate; (ii) disteroylphosphatidylcholine; (iii) cholesterol; and (iv) PEG2k-DMG.
  15. 64 . The composition of claim 51 , wherein the mRNA encoding the SpyCas9 protein comprises, at the 5′ end, an anti-reverse cap analog comprising a 7-methylguanine 3′-methoxy-5′-triphosphate linked to the 5′ position of a guanine ribonucleotide and, at the 3′ end, at least 20 adenine nucleotides (a poly-A tail).
  16. 65 . The composition of claim 51 , wherein the mRNA encoding the SpyCas9 protein comprises the RNA sequence of SEQ ID NO:516.
  17. 66 . The composition of claim 51 , wherein the mRNA encoding the SpyCas9 protein comprises a modified uridine at one, a plurality of, or all of the positions occupied by uridine in the mRNA.
  18. 67 . The composition of claim 66 , wherein the modified uridine is N1-methylpseudouridine.
  19. 68 . The composition of claim 51 , wherein the composition comprises: (a) a single guide RNA (sgRNA) comprising mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmA mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAm GmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 603), wherein a * denotes a PS bond and “mA,” “mC,” “mU,” and “mG” each denote a nucleotide containing a 2′-O-Me modification; (b) the mRNA comprising a sequence encoding the SpyCas9 protein; and (c) a lipid nanoparticle comprising an ionizable lipid.
  20. 69 . The composition of claim 68 , wherein the sgRNA consists of mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmA mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAm GmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 603).

Description

CROSS-REFERENCE TO RELATED APPLICATIONS This patent application is a divisional application of U.S. application Ser. No. 17/882,099, filed Aug. 5, 2022, which is a continuation of International Application No. PCT/US2021/016730, filed Feb. 5, 2021, which claims priority to U.S. Provisional Patent Application No. 62/971,906, filed Feb. 7, 2020; U.S. Provisional Patent Application No. 62/981,965, filed Feb. 26, 2020; and U.S. Provisional Patent Application No. 63/019,076, filed May 1, 2020, the contents of each of which are incorporated herein by reference in their entirety for all purposes. INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ON A READ-ONLY OPTICAL DISC AS AN XML FILE VIA THE PATENT ELECTRONIC SYSTEM The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on Nov. 18, 2024, is named “01155-0031-00US.xml” and is 2,202,442 bytes in size. BACKGROUND Hereditary angioedema (HAE) affects one in 50,000 people and contributes to 15,000 to 30,000 emergency room visits per year. HAE is a rare autosomal, dominantly inherited blood disorder characterized by recurrent episodes of severe swelling (angioedema). The most common areas of the body to develop swelling are the limbs, face, GI tract, and airway. Minor trauma or stress may trigger an attack but swelling often occurs without a known trigger. Episodes involving the intestinal tract cause severe abdominal pain, nausea, and vomiting. Swelling in the airway can restrict breathing and lead to life-threatening obstruction of the airway or asphyxiation. Symptoms of HAE typically begin in childhood and worsen during puberty. On average, untreated individuals have an attack every 1 to 2 weeks, and most episodes last for about 3 to 4 days. There are three types of hereditary angioedema, called types I, II, and III, and the different types have similar signs and symptoms. Hereditary angioedema stems from excess bradykinin in the blood promoting vascular permeability and episodes of swelling. Most patients with HAE have a C1 inhibitor (also called C1 esterase inhibitor or C1-INH) protein deficiency. In the absence of C1-INH, bradykinin levels can rise, initiate vascular leakage, and cause swelling attacks. Its production is controlled via the kallikrein-kinin (contact) pathway which is endogenously inhibited by C1-INH. Bradykinin peptide is formed when high-molecular weight kininogen (HMWK) is cleaved by plasma kallikrein (pKal), an activated form of the protein prekallikrein. Prekallikrein is encoded by KLKB1 and is also called KLKB1 protein. KLKB1 protein is produced in the liver and secreted into plasma where it can be activated by factor XIIa. Once KLKB1 is activated, pKal can increase bradykinin levels. An excess of bradykinin in the blood leads to fluid leakage through the walls of blood vessels into body tissues. Excessive accumulation of fluids in body tissues causes the episodes of swelling seen in individuals with HAE. Several drugs targeting the kallikrein-kinin pathway have been developed, including C1 esterase inhibitors (Berinert®, Cinryze®), recombinant C1-INH replacement therapy (rhC1INH; conestat alfa (Rhucin®, Ruconest®)), and bradykinin receptor antagonist (Icatibant, Firazyr®). Approaches using kallikrein or prekallikrein (KLKB1) inhibitors also have been developed (ecallantide, Kalbitor®; lanadelumab, Takhzyro™). BRIEF SUMMARY The present disclosure provides compositions and methods using the CRISPR/Cas system to knock out the KLKB1 gene, thereby reducing the production of prekallikrein (KLKB1), reducing kallikrein, and reducing bradykinin production in subjects with HAE. Accordingly, the following embodiments are provided. In some embodiments, the present invention provides compositions and methods using a guide RNA with an RNA-guided DNA binding agent such as the CRISPR/Cas system to substantially reduce or knockout expression of the KLKB1 gene, thereby substantially reducing or eliminating the production of bradykinin. The substantial reduction or elimination of the production of bradykinin through alteration of the KLKB1 gene can be a long-term or permanent treatment. The following embodiments are provided herein. Embodiment A1 is a guide RNA comprising: a. a guide sequence comprising at least 95%, 90%, or 85% identity to a sequence selected from SEQ ID NOs: 15, 8, and 41;b. a guide sequence comprising at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 15, 8, and 41; orc. a guide sequence selected from SEQ ID NOs: 15, 8, and 41. Embodiment A2 is the guide RNA of embodiment A1, further comprising the nucleotide sequence of SEQ ID NO: 202. Embodiment A3 is the guide RNA of embodiment A1, wherein the guide RNA further comprises a nucleotide sequence selected from SEQ ID NO: 170, 171, 172, and 173 wherein the sequence of SEQ ID NO: 170, 171, 172, or 173 is 3′ of the guide seque