US-20260125685-A1 - THERAPEUTIC AGENT FOR TREATING HIF-1alpha-MEDIATED DISEASES BY INHIBITING AREL1 AND RESTORING PHD2 ACTIVITY
Abstract
Provided are agents and methods for treating or preventing diseases mediated by pathological HIF-1α activity. The disclosure provides an AREL1 inhibitor that restores PHD2 stability or activity and thereby decreases HIF-1α protein level and/or transcriptional activity. In exemplary embodiments, inhibition of AREL1 decreases expression of HIF-1α target genes such as VEGF and suppresses angiogenesis, supporting use of the disclosed agents for treating cancer and other angiogenesis-driven disorders. In some embodiments, the diseases include autoimmune and inflammatory diseases.
Inventors
- Deug-Yong SHIN
Assignees
- BIOCHEMGEN INC.
Dates
- Publication Date
- 20260507
- Application Date
- 20260106
- Priority Date
- 20230712
Claims (20)
- 1 . A method of treating a HIF-1α-related disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an inhibitory nucleic acid that inhibits expression of apoptosis-resistant E3 ubiquitin protein ligase 1 (AREL1), thereby increasing a level or activity of prolyl hydroxylase domain-containing protein 2 (PHD2) and decreasing hypoxia-inducible factor-1 alpha (HIF-1α) activity in cells of the subject.
- 2 . The method of claim 1 , wherein the inhibitory nucleic acid is selected from siRNA, shRNA, antisense oligonucleotide, and microRNA.
- 3 . The method of claim 1 , wherein the inhibitory nucleic acid comprises AATTGGTCCCTGAGAACCTTT (SEQ ID NO:1), or a sequence having at least 90% identity thereto and retaining AREL1 knockdown activity.
- 4 . The method of claim 1 , wherein administering comprises delivering the inhibitory nucleic acid in a lipid nanoparticle (LNP) formulation or a liposome formulation.
- 5 . The method of claim 1 , wherein administering comprises systemic administration.
- 6 . The method of claim 1 , wherein decreasing HIF-1α activity comprises decreasing HIF-1α transcriptional activity measured by an HIF-responsive element (HRE) reporter assay.
- 7 . The method of claim 1 , wherein the HIF-1α-related disease is an autoimmune or inflammatory disease selected from rheumatoid arthritis, psoriasis, alopecia areata, type 1 diabetes, Graves' disease, Hashimoto's thyroiditis, vitiligo, Crohn's disease, and ulcerative colitis.
- 8 . The method of claim 7 , wherein the autoimmune or inflammatory disease is rheumatoid arthritis.
- 9 . The method of claim 7 , further comprising administering a second therapeutic agent selected from corticosteroids, immunomodulators, anti-cytokine biologics, and small-molecule immunosuppressants.
- 10 . The method of claim 1 , wherein the HIF-1α-related disease is cancer.
- 11 . A method of treating a HIF-1α-related disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an agent that inhibits an interaction between AREL1 protein and PHD2 protein, thereby increasing PHD2 protein level and decreasing HIF-1α activity in cells of the subject.
- 12 . The method of claim 11 , wherein the agent is selected from a small molecule, a peptide, an antibody, and an inhibitory nucleic acid.
- 13 . The method of claim 11 , wherein the agent reduces ubiquitination of PHD2 in cells.
- 14 . The method of claim 11 , wherein decreasing HIF-1α activity comprises decreasing HIF-1α transcriptional activity measured by an HRE reporter assay.
- 15 . The method of claim 11 , wherein the method decreases expression of a HIF-1α target gene selected from VEGF, CA9, and GLUT1.
- 16 . A pharmaceutical composition comprising (i) an AREL1 inhibitor and (ii) a pharmaceutically acceptable carrier, wherein the AREL1 inhibitor is configured to increase PHD2 level or activity and decrease HIF-1α activity in a cell.
- 17 . The pharmaceutical composition of claim 16 , wherein the AREL1 inhibitor is an inhibitory nucleic acid that inhibits expression of AREL1.
- 18 . The pharmaceutical composition of claim 16 , wherein the AREL1 inhibitor is an agent that inhibits an interaction between AREL1 protein and PHD2 protein.
- 19 . The pharmaceutical composition of claim 16 , wherein the composition is formulated as an LNP formulation for systemic administration.
- 20 . A kit comprising the pharmaceutical composition of claim 16 and instructions for use to treat a HIF-1α-related disease by increasing PHD2 and decreasing HIF-1α activity.
Description
INCORPORATION OF SEQUENCE LISTING This application contains a sequence listing submitted in Computer Readable Form (CRF). The CRF file containing the sequence listing entitled “PK002597882-SequenceListing.xml”, which was created on Jan. 2, 2026, and is 2034 bytes in size. The information in the sequence listing is incorporated herein by reference in its entirety. TECHNICAL FIELD The present disclosure relates to therapeutic and preventive agents for diseases associated with pathological activation of hypoxia-inducible factor-1 alpha (HIF-1α). More particularly, the disclosure relates to agents that inhibit apoptosis-resistant E3 ubiquitin protein ligase 1 (AREL1), or that inhibit an interaction between AREL1 and prolyl hydroxylase domain-containing protein 2 (PHD2), thereby increasing PHD2 stability or activity and reducing HIF-1α activity. The agents are useful, for example, for treating cancers and other angiogenesis-driven disorders. BACKGROUND ART HIF-1α is a transcription factor that enables cellular adaptation to hypoxia. Under normoxia, HIF-1a is hydroxylated by PHD2 and subsequently recognized by the von Hippel-Lindau (VHL) ubiquitin ligase complex, leading to proteasomal degradation. Under hypoxia, PHD2 activity is reduced, HIF-1α accumulates, and HIF-1α activates expression of hypoxia-responsive genes, including genes involved in angiogenesis, metabolism, invasion, and survival. Pathological activation of HIF-1α has been implicated in tumor growth, therapy resistance, metastasis, and abnormal angiogenesis. Accordingly, there is a need for therapeutic strategies that reduce HIF-1α activity in diseases where HIF-1α is aberrantly elevated. Pathological HIF-1α activation has also been implicated in immune dysregulation and chronic inflammation, including autoimmune and inflammatory diseases such as rheumatoid arthritis, psoriasis, inflammatory bowel disease, and autoimmune thyroid diseases. AREL1 (also known as RANI1 in earlier literature) is an E3 ubiquitin ligase previously associated with anti-apoptotic signaling. However, the role of AREL1 in regulating the PHD2-HIF-1α axis and angiogenesis has not been fully elucidated. The present disclosure identifies AREL1 as a regulator that promotes HIF-1α accumulation by targeting PHD2 for ubiquitination and degradation, and provides therapeutic approaches based on inhibiting AREL1 to restore PHD2 function and suppress HIF-1α activity. DISCLOSURE Technical Problem An object of the present disclosure is to provide agents and methods for treating or preventing diseases mediated by pathological HIF-1α activity, including cancers and other angiogenesis-driven disorders, by suppressing HIF-1α activity through modulation of the AREL1-PHD2-HIF-1a pathway. In some embodiments, the diseases include cancer and non-cancer HIF-1α-related diseases, including autoimmune and inflammatory diseases in which pathological HIF-1α signaling contributes to disease progression. Another object is to provide agents that inhibit expression or activity of AREL1, or that inhibit an interaction between AREL1 protein and PHD2 protein, thereby stabilizing PHD2 and reducing HIF-1α protein level and/or transcriptional activity. The objects of the present disclosure are not limited to those described above, and other objects will be apparent to those skilled in the art from the following description. Technical Solution In one aspect, provided is a pharmaceutical composition comprising, as an active ingredient, an AREL1 inhibitor and a pharmaceutically acceptable carrier. In some embodiments, the HIF-1α-related disease comprises an autoimmune or inflammatory disease selected from rheumatoid arthritis, psoriasis, alopecia areata, type 1 diabetes, Graves' disease, Hashimoto's thyroiditis, vitiligo, Crohn's disease, and ulcerative colitis. In some embodiments, the HIF-1α-related disease comprises cancer, including solid tumors characterized by hypoxia, angiogenesis, and elevated HIF-1α activity. As used herein, an “AREL1 inhibitor” includes any agent that (i) reduces expression of AREL1, (ii) inhibits enzymatic activity of AREL1 (including E3 ubiquitin ligase activity), and/or (iii) inhibits binding between AREL1 protein and PHD2 protein. Non-limiting examples of AREL1 inhibitors include inhibitory nucleic acids (e.g., siRNA, shRNA, antisense oligonucleotides, microRNA, ribozymes), antibodies or antigen-binding fragments that specifically bind AREL1 and inhibit its function, peptides that competitively inhibit the AREL1-PHD2 interaction, aptamers, and small-molecule compounds identified by screening. In certain embodiments, the inhibitory nucleic acid targets AREL1 mRNA. In a specific embodiment, the inhibitory nucleic acid comprises the sequence: AATTGGTCCCTGAGAACCTTT (SEQ ID NO:1), or a sequence having at least 90% identity thereto and retaining AREL1 knockdown activity. SEQ ID NO:1: AATTGGTCCCTGAGAACCTTT (shRNA/siRNA target sequence against AREL1) In another aspect, provided is a method of t